docs: update docstring of some methods

src/findorfs.jl

@@ -1,14 +1,14 @@
 export findorfs
 
 """
-    findorfs(sequence::NucleicSeqOrView{DNAAlphabet{N}}; ::M, kwargs...) where {N, M<:GeneFinderMethod}
+    findorfs(sequence::NucleicSeqOrView{DNAAlphabet{N}}; ::F, kwargs...) where {N, F<:GeneFinderMethod}
 
 This is the main interface method for finding open reading frames (ORFs) in a DNA sequence.
 
 It takes the following required arguments:
 
 - `sequence`: The nucleic acid sequence to search for ORFs.
-- `method`: The algorithm used to find ORFs. It can be either `NaiveFinder()`, `NaiveFinderScored()` or yet other implementations.
+- `finder`: The algorithm used to find ORFs. It can be either `NaiveFinder`, `NaiveCollector` or yet other implementations.
 
 ## Keyword Arguments regardless of the finder method:
 - `alternative_start::Bool`: A boolean indicating whether to consider alternative start codons. Default is `false`.
@@ -26,7 +26,7 @@ sequence = randdnaseq(120)
 120nt DNA Sequence:
  GCCGGACAGCGAAGGCTAATAAATGCCCGTGCCAGTATC…TCTGAGTTACTGTACACCCGAAAGACGTTGTACGCATTT
 
-findorfs(sequence, NaiveFinder())
+findorfs(sequence, finder=NaiveFinder)
 
 1-element Vector{ORF}:
  ORF{NaiveFinder}(77:118, '-', 2, 0.0)

src/types.jl

@@ -42,7 +42,7 @@ The `ORF` struct represents an Open Reading Frame (ORF) in genomics.
 - `features::Features`: The features associated with the ORF.
 - `scheme::Union{Nothing,Function}`: The scheme used for the ORF.
 
-# Constructor
+# Main Constructor
 
 ```julia
 ORF{N,F}(
@@ -54,7 +54,7 @@ ORF{N,F}(
     features::Features,
     scheme::Union{Nothing,Function}
 )
-
+```
 # Example
 
 A full instance `ORF`
@@ -194,7 +194,7 @@ Extracts the features from an `ORF` object.
 - `i::ORF{N,F}`: An `ORF` object.
 
 # Returns
-The features of the `ORF` object.
+The features of the `ORF` object. Those could be defined by each `GeneFinderMethod`.
 
 """
 function features(i::ORF{N,F}) where {N,F}